View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15672_high_36 (Length: 300)
Name: NF15672_high_36
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15672_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 200 - 291
Target Start/End: Complemental strand, 56230559 - 56230468
Alignment:
| Q |
200 |
taaaagagtggacctgttgcaacggaagcctgtgtgatcactctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56230559 |
taaaagagtggacctgttgcaacggaagcctgtgtgatcactctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc |
56230468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 16 - 130
Target Start/End: Complemental strand, 56230755 - 56230637
Alignment:
| Q |
16 |
tcaccggtgatatatctattaatttgctttaatcatagagatatatagtaaacacaagcaatactataattagcgatagtaaagaatgtgtaacc----g |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
56230755 |
tcactggtgatatatctattaatttgctttaatcttagagacatatagtaaacacaagcaatactataattagcgatagtaaagaatgtgtaactaactg |
56230656 |
T |
|
| Q |
112 |
atcagaacacatagcatac |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
56230655 |
atcagaacacatagcatac |
56230637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 39188366 - 39188286
Alignment:
| Q |
211 |
acctgttgcaacggaagcctgtgtgatcactctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39188366 |
acctgttgcaacggaagcctgtgtgatcattctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc |
39188286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University