View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15672_high_39 (Length: 279)
Name: NF15672_high_39
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15672_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 22 - 269
Target Start/End: Original strand, 43529601 - 43529848
Alignment:
| Q |
22 |
acgctatcttataatgattcgattatagctcattatgttgctcctgaaatgttctttggtttttcagcttcgaaaacgaattggattgaagcgcagagag |
121 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529601 |
acgctatcttataatgattcgagtatagctcattatgttgctcctgaaatgttctttggtttttcagcttcgaaaacgaattggattgaagcgcagagag |
43529700 |
T |
|
| Q |
122 |
ttttagcatggagttttagtgatgatgggagtttgaaagagttgaacacgacaaatttaccggtgtttaagcgaggatcatcttcgtcttcactttccag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529701 |
ttttagcatggagttttagtgatgatgggagtttgaaagagttgaacacgacaaatttaccggtgtttaagcgaggatcatcttcgtcttcactttccag |
43529800 |
T |
|
| Q |
222 |
tggagctattgctgggattgcagttggttgttttgtttttgttctgtg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43529801 |
tggagctattgctgggattgcagttggttgttttgtttttgttgtgtg |
43529848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University