View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15672_high_42 (Length: 259)
Name: NF15672_high_42
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15672_high_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 240
Target Start/End: Complemental strand, 52271236 - 52271011
Alignment:
| Q |
15 |
gatgaaatgatgattatttttgtttttatatcaaaattgtaatgtgtaacaggagaagaacgctcaattcttttcaccggctgaagatgaaagcagcaga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271236 |
gatgaaatgatgattatttttgtttttatatcaaaattgtaatgtgtaacaggagaagaacgctcaattcttttcaccggctgaagatgaaagcagcagg |
52271137 |
T |
|
| Q |
115 |
ggagttttcaatctcataaagaaattaaatgttgttcctgataccaggataaaaggaagaactccatgtaagatctattaattttagtatttcacgaaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52271136 |
ggagttttcaatctcataaagaaattaaatgttgttcctgataccaggataaaaggaagaattccatgtaagatctattaattttagtatttcacgaaat |
52271037 |
T |
|
| Q |
215 |
tgacaaaacctatgcaatgtacacca |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52271036 |
tgacaaaacctatgcaatgtacacca |
52271011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University