View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15672_high_57 (Length: 224)
Name: NF15672_high_57
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15672_high_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 23892463 - 23892649
Alignment:
| Q |
19 |
ggtggaagggagaatttcaatacatccaaaaccattttcacataaatgatcccctaaagagggtgctgcactagctgccactgacatggactcaactgca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23892463 |
ggtggaagggagaatttcaatacatccaaaaccattttcacataaatgatcccctaaagagggtgctggactagctgccactgacatggactcaactgca |
23892562 |
T |
|
| Q |
119 |
tattcaatcacaaaatacagaaattacaaagttaaaaacaaataaccaaatttgaaagtcaaatcctgagctctttatgttgaatca |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23892563 |
tattcaatcacaaaatacagaaaatacaaagtaaaaaacaaatcaacaaatttgaaagtcaaatcctgagctctttatgttgaatca |
23892649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University