View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15672_low_24 (Length: 373)
Name: NF15672_low_24
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15672_low_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 243 - 373
Target Start/End: Complemental strand, 14089676 - 14089544
Alignment:
| Q |
243 |
ttgagaaggtcggaaacttagaatcatagtatgatgtgcacaatgatctaattcctacaatttaaaagaaactttggcgtggaagctttgtttttgaata |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14089676 |
ttgagaaggtcggaaacttagaatcatagtatgatgtgcacaatgatctaattcctacaatttaaaagaaactttggcgtggaagctttgtttttgaata |
14089577 |
T |
 |
| Q |
343 |
att--gaaacaaaggctatagtagactgtgaac |
373 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
14089576 |
attgagaaacaaaggctatagtagactgtgaac |
14089544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University