View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15672_low_39 (Length: 290)
Name: NF15672_low_39
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15672_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 80 - 272
Target Start/End: Complemental strand, 28137335 - 28137138
Alignment:
| Q |
80 |
gtataacgcatgatgcatccaacggattatattaagcgaatgtaactgtgggtttcccgcgtgaaagacagagaatcagtttccgttacactagcgccat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28137335 |
gtataacgcatgatgcatccaacggattatactaagcgaaagtaactgtgggtttcccgcgtgaaagacagagaatcagtttccgttacactagcgccat |
28137236 |
T |
|
| Q |
180 |
taccagtg-----gcattccttcaaatcaatcaccgagcacacgcacctcacggaacggatcttcattctcattcttaatcacaaaccgaaccttttg |
272 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28137235 |
taccagtggcatggcattccttcaaatcaatcaccgagcacacgcacctcacggaacggatcttcattctcattctcaatcacaaaccgaaccttttg |
28137138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University