View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15672_low_4 (Length: 596)

Name: NF15672_low_4
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15672_low_4
NF15672_low_4
[»] chr4 (4 HSPs)
chr4 (17-194)||(56164283-56164453)
chr4 (388-475)||(49445799-49445886)
chr4 (473-521)||(49445919-49445967)
chr4 (388-460)||(55709717-55709789)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 2e-53; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 56164453 - 56164283
Alignment:
17 tgaatctggaatggagctaaccctgtcttctgttggaatggatcgatatggttgagaagaagacatgatattgatagcaattacaaaattaagatcaaag 116  Q
    |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||      ||||||||||||||||||||||||    
56164453 tgaatctggaatggagctaaccctatcttctgttggaatgaatcgatatggttgagaagaagacatgata------gcaattacaaaattaagatcaaag 56164360  T
117 caatttgtcgtagcacaatgtcactgatgaactggggtttcgatgcaattatatattcatgtgatcaatcaataattt 194  Q
    |||||| ||||   |||| ||||| ||||||  ||| |||||||||||||||||||||||||||||||||||||||||    
56164359 caatttctcgtcatacaacgtcacggatgaaaaggg-tttcgatgcaattatatattcatgtgatcaatcaataattt 56164283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 388 - 475
Target Start/End: Original strand, 49445799 - 49445886
Alignment:
388 ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaagatgataaacgtaacag 475  Q
    |||||||||||||||| |||||| | |||||||||||| ||| ||||| ||||| || ||||||||||||||||||| ||| ||||||    
49445799 ttactttggcttctcgtgatcaattgactgctagcagcacattaaacattttggcaaggtgtcctgtacaagatgatgaacttaacag 49445886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 473 - 521
Target Start/End: Original strand, 49445919 - 49445967
Alignment:
473 cagaactcatatctcattgtctagctacaatgctcatgattcgggtaaa 521  Q
    ||||||||||||||||||||||||||||| |||||||||||| ||||||    
49445919 cagaactcatatctcattgtctagctacactgctcatgattcaggtaaa 49445967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 460
Target Start/End: Original strand, 55709717 - 55709789
Alignment:
388 ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaaga 460  Q
    ||||| ||||||||||||||||| | ||||| |||||| ||| ||||| ||||| || |||||||||||||||    
55709717 ttactctggcttctcgggatcaattgactgccagcagcacattaaacattttggcaaggtgtcctgtacaaga 55709789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University