View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15672_low_49 (Length: 240)
Name: NF15672_low_49
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15672_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 2111453 - 2111239
Alignment:
| Q |
18 |
acactgtctcttgatcttcccatggagggagggtagagtgaaaatggtggttgatcaccttggagaaacggtggtggagagacagcaaagaaagagaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2111453 |
acactgtctcttgatcttcccatggagggagggtagagtgaaaatggtggttgatcaccttggagaaacggtggtggagagacagcaaagaaagagaaaa |
2111354 |
T |
 |
| Q |
118 |
tggggagtaatgagaggttggtgag-aaccattgtatc-----tatgatctatggtctcattggtttgttgctatggaatgctagaagtggaaacttttg |
211 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2111353 |
tggggagttatgagaggttggtgagaaaccattgtatctatgatatgatctatggtctcattggtttgttgctatggaaagctagaagaggaaacttttg |
2111254 |
T |
 |
| Q |
212 |
tgtttctgcatgaaa |
226 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
2111253 |
tgtatctgcatgaaa |
2111239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 144 - 226
Target Start/End: Complemental strand, 2129529 - 2129447
Alignment:
| Q |
144 |
accattgtatctatgatctatggtctcattggtttgttgctatggaatgctagaagtggaaacttttgtgtttctgcatgaaa |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2129529 |
accattgtatctatgatctatggcctcattggtttgttgtgatgaaatgctagaagtggaaagttttgtgtttctgcatgaaa |
2129447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 74
Target Start/End: Complemental strand, 2129585 - 2129540
Alignment:
| Q |
29 |
tgatcttcccatggagggagggtagagtgaaaatggtggttgatca |
74 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
2129585 |
tgatcttcccatggaaggaggctagagtgaaaatggtggttgatca |
2129540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University