View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15672_low_49 (Length: 240)

Name: NF15672_low_49
Description: NF15672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15672_low_49
NF15672_low_49
[»] chr6 (3 HSPs)
chr6 (18-226)||(2111239-2111453)
chr6 (144-226)||(2129447-2129529)
chr6 (29-74)||(2129540-2129585)


Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 2111453 - 2111239
Alignment:
18 acactgtctcttgatcttcccatggagggagggtagagtgaaaatggtggttgatcaccttggagaaacggtggtggagagacagcaaagaaagagaaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2111453 acactgtctcttgatcttcccatggagggagggtagagtgaaaatggtggttgatcaccttggagaaacggtggtggagagacagcaaagaaagagaaaa 2111354  T
118 tggggagtaatgagaggttggtgag-aaccattgtatc-----tatgatctatggtctcattggtttgttgctatggaatgctagaagtggaaacttttg 211  Q
    |||||||| |||||||||||||||| ||||||||||||     |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||    
2111353 tggggagttatgagaggttggtgagaaaccattgtatctatgatatgatctatggtctcattggtttgttgctatggaaagctagaagaggaaacttttg 2111254  T
212 tgtttctgcatgaaa 226  Q
    ||| |||||||||||    
2111253 tgtatctgcatgaaa 2111239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 144 - 226
Target Start/End: Complemental strand, 2129529 - 2129447
Alignment:
144 accattgtatctatgatctatggtctcattggtttgttgctatggaatgctagaagtggaaacttttgtgtttctgcatgaaa 226  Q
    ||||||||||||||||||||||| |||||||||||||||  ||| ||||||||||||||||| ||||||||||||||||||||    
2129529 accattgtatctatgatctatggcctcattggtttgttgtgatgaaatgctagaagtggaaagttttgtgtttctgcatgaaa 2129447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 74
Target Start/End: Complemental strand, 2129585 - 2129540
Alignment:
29 tgatcttcccatggagggagggtagagtgaaaatggtggttgatca 74  Q
    ||||||||||||||| ||||| ||||||||||||||||||||||||    
2129585 tgatcttcccatggaaggaggctagagtgaaaatggtggttgatca 2129540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University