View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15673_high_36 (Length: 214)
Name: NF15673_high_36
Description: NF15673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15673_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 25535116 - 25534938
Alignment:
| Q |
21 |
gggacttgtttcatggcatgttagacgatcatacacctcccacttttcatgctgtcaactctgacacttttattttgatggtcgatgaatgcttgaagct |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25535116 |
gggacttgtttcatggcatgttagacaatcatacacctcccacttttcatgctgtcaactctgacacttttattttgatggtcgatgaatgcttgaagct |
25535017 |
T |
 |
| Q |
121 |
tggtaaaattgatgaagcccttgcaactttgaagaaagttggaaccaagcctgattctaggccttttttcttggatatt |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25535016 |
tggtaagattgatgaagcccttgcaactttgaagaaagttggaaccaagcctgattctaggccttttttcttggatatt |
25534938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 21 - 196
Target Start/End: Complemental strand, 25527084 - 25526909
Alignment:
| Q |
21 |
gggacttgtttcatggcatgttagacgatcatacacctcccacttttcatgctgtcaactctgacacttttattttgatggtcgatgaatgcttgaagct |
120 |
Q |
| |
|
||||||||||||||| |||||||||| |||| || ||| |||||||||||| |||| ||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
25527084 |
gggacttgtttcatgacatgttagacaatcacacgccttccacttttcatggtgtcgactctgacacttttactttgatggtcgaggaatgcttgaagct |
25526985 |
T |
 |
| Q |
121 |
tggtaaaattgatgaagcccttgcaactttgaagaaagttggaaccaagcctgattctaggccttttttcttggat |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
25526984 |
cggtaaggttgatgaagcccttgcaactttgaagaaagttggaaccaaacctgattctaagccttttttcttggat |
25526909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 21 - 196
Target Start/End: Original strand, 25515332 - 25515514
Alignment:
| Q |
21 |
gggacttgtttcatggcatgttagacgatcatacacctcccacttttcatgctgtcaactctgacacttttattttgatggtcgatgaatgcttgaagct |
120 |
Q |
| |
|
||||||||||||||| |||||||||| |||| ||||||||||||||||||| ||| ||||| ||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
25515332 |
gggacttgtttcatgacatgttagacaatcacacacctcccacttttcatggtgttgactctaacacttttattgtgatggtcaatgaatgcttcaagct |
25515431 |
T |
 |
| Q |
121 |
tggtaaaattgatgaagcccttgcaactttgaagaaag-------ttggaaccaagcctgattctaggccttttttcttggat |
196 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25515432 |
tggtaaggttgatgaagcccttgcaactttgaagaaagttggaacttggaaccaagcctgattctaagccttttttcttggat |
25515514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University