View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15673_low_31 (Length: 241)
Name: NF15673_low_31
Description: NF15673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15673_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 3429726 - 3429837
Alignment:
| Q |
18 |
caaacatctttttctttttctgtttcacgcaatctctaatatccattgccttaaatgaaagaaatctatcaaactccacgtggaaccaagcaaaa-cccc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3429726 |
caaacatctttttctttttctgtttcacgcaatctctaatatccattgccttaaatgaaagaaatctatcaaactccacgtggaaccaagcaaaaccccc |
3429825 |
T |
 |
| Q |
117 |
caatcgatgtgt |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3429826 |
caatcgatgtgt |
3429837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 223
Target Start/End: Original strand, 3429895 - 3429929
Alignment:
| Q |
189 |
ctctgtaaattaagaaactcaatgttagagagtct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429895 |
ctctgtaaattaagaaactcaatgttagagagtct |
3429929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University