View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15673_low_36 (Length: 221)
Name: NF15673_low_36
Description: NF15673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15673_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 10446099 - 10445904
Alignment:
| Q |
16 |
aaattgacatatttgctctaaagttttttattaacgtaaccaagttctagtaaaagggacatgccaccatacaatccagttgtcatattgatannnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10446099 |
aaattgacatatttgctctaaagttttttattaacgtaaccaagttctagtaaaagggacatgccaccatacaatccagttgtcatattgatattttttt |
10446000 |
T |
 |
| Q |
116 |
nctctcggtttgttctggttatttatggtgaagttaaactatagcattatattattatattggtgccatgtggcttgctggtactggccacaggtt |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10445999 |
tctctcggtttgttctggttttttatggtgaagttaaactatagcattatattattatattggtgccatgtggcttgctggtactggccacaggtt |
10445904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University