View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15673_low_38 (Length: 213)
Name: NF15673_low_38
Description: NF15673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15673_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 10676101 - 10676297
Alignment:
| Q |
1 |
atgcaaaatttttatttttaaattctttaacatatgttcttatgccacaaattagcaagacataaattaaactaaatatttttgttaagaattagaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10676101 |
atgcaaaatttttatttttaaattttttaacacatgttcttatgccacaagttagcaagacataaattaaactaaatatttttgttaagaattggaaaca |
10676200 |
T |
 |
| Q |
101 |
actcaaatattacattttttatcggaagaagtgaataatgaagtaaaaaactttacagttaagtatgagtctcccacaacatatacatgacctaaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| || | |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10676201 |
actcaaatattacattttttatcggaagaagtgaataatgaagtaaaaaaatttgcactcaagtatgagtctcccacatcatatacatgacctaaat |
10676297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University