View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15673_low_42 (Length: 202)

Name: NF15673_low_42
Description: NF15673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15673_low_42
NF15673_low_42
[»] chr4 (1 HSPs)
chr4 (19-186)||(52767952-52768119)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 52768119 - 52767952
Alignment:
19 agatgcttggtgaggtaaccccttaattcaaaatttcaacttgcaagatgatgaagagctcaatgcaaattcaacggctagcgaatttattcaaaattac 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
52768119 agatgcttggtgaggtaaccccttaattcaaaatttcaacttgcaagatgatgaagagctcaatgcaaattcaacggttagcgaatttattcaaaattac 52768020  T
119 cattggaatatgccagccgatttgtgcgaaaatcttccagtcctgaggcaacttgtggtgcaagttat 186  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||    
52768019 cattggaatatgccagccggtttgtgcgaaaatcttccggtcctgaggcaacttgtggtgcaagttat 52767952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University