View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15674_low_10 (Length: 275)
Name: NF15674_low_10
Description: NF15674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15674_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 92 - 257
Target Start/End: Complemental strand, 9813476 - 9813311
Alignment:
| Q |
92 |
caaatatgtccccagaaaccttattaaattgttgccaattaaattgtctcataagcacatgattgctcatctttggcagccttgtaaaggagtcaccaat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9813476 |
caaatatgtccccagaaaccttattaaattgttgccaattaaattgtctcataagcacatgcttgctcatctttggcagccttgtaaaggagtcaccaat |
9813377 |
T |
|
| Q |
192 |
accatcactcctattcatgaaaagaaattgtctggctacctatgccccgacagttccagcttatac |
257 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9813376 |
accatcactccttttcatgaaaagaaattgtctggctacctatgccccggcagttccagcttatac |
9813311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 12 - 74
Target Start/End: Complemental strand, 9813570 - 9813508
Alignment:
| Q |
12 |
cttagagaaaaattgaatgagttttcctatgaatattaatatgagggatgtgctcattggtcg |
74 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9813570 |
cttagagaaaaattgaatgagtttgactatgaatattagtatgagggatgtgctcattggtcg |
9813508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University