View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15674_low_13 (Length: 217)
Name: NF15674_low_13
Description: NF15674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15674_low_13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 45793293 - 45793509
Alignment:
| Q |
1 |
gagtcatgccaaacaatttatcttttggattatagtgatctcctgatttaagctacattggaagctttgaagtttaacagaatgagattgaatgtaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793293 |
gagtcatgccaaacaatttatcttttggattatagtgatctcctgatttaagctacattggaagctttgaagtttaacagaatgagattgaatgtaagaa |
45793392 |
T |
|
| Q |
101 |
ggggaagggatgaaatcaaatagttaaacttacaaatttttggactaataatgagagagtaattgggaaggtaaaaggctttaactgttaaatgttaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793393 |
ggggaagggatgaaatcaaatagttaaacttacaaatttttggactaataatgagagagtaattcggaaggtaaaaggctttaactgttaaatgttaaat |
45793492 |
T |
|
| Q |
201 |
ttcaattatttttctta |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45793493 |
ttcaattatttttctta |
45793509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 45793218 - 45793251
Alignment:
| Q |
1 |
gagtcatgccaaacaatttatcttttggattata |
34 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
45793218 |
gagtcatgtcaaacaatttatcttttggattata |
45793251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University