View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15674_low_3 (Length: 460)
Name: NF15674_low_3
Description: NF15674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15674_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 294 - 440
Target Start/End: Original strand, 47039751 - 47039897
Alignment:
| Q |
294 |
ccatgaaagtgcaaacactacttcatcaaactgaaaagaccaaaataatggcaaagctttttatcaaaggatttaatatcatcgttttttcgaagtattt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47039751 |
ccatgaaagtgcaaacactacttcatcaaaccgaaaagaccaacataatggcaaagctttttatcaaaggatttaatatcatcgttttttcgaagtattt |
47039850 |
T |
|
| Q |
394 |
aagattactgcatcattatgactgagttcgaacatatatcttctaat |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47039851 |
aagattactgcatcattatgactgagttcgaacatatatcttctaat |
47039897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 74 - 202
Target Start/End: Original strand, 47039530 - 47039659
Alignment:
| Q |
74 |
gaagaatgtaaactaccc-atcgaaattgggatgttaagaatccaatatgagattttaaatgaacatattctaaggtctcaagctaacatcatcaagcca |
172 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47039530 |
gaagaatgtaaactaccccatcgaaattgggatgttgagaatcgaatatgagattttaaaggaacatattctaaggtctcaagctaacatcatcaagcca |
47039629 |
T |
|
| Q |
173 |
atcaaaatggagaataaaataaaatataga |
202 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
47039630 |
attaaaatggagaataaaataaaatataga |
47039659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University