View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15676_high_8 (Length: 321)
Name: NF15676_high_8
Description: NF15676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15676_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 51112660 - 51112971
Alignment:
| Q |
1 |
atctgcatagctttcgtcagcagcataatgtttggtcttttcagaagcatcagtggcataatctctgattttcttagaagcatcccaagcatagcctttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112660 |
atctgcatagctttcgtcagcagcataatgtttggtcttctcagaagcatcagtggcataatctctgattttcttagaagcatcccaagcatagcctttg |
51112759 |
T |
 |
| Q |
101 |
gttttctcagcagcatcatgggcatggtcactggctttttgagcagtttccttggacttgtgtgcagtttcatctgcatagtgtttggttttgtgtgcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112760 |
gttttctcagcagcatcatgggcatggtcactggctttttgagcagtttccttggacttgtgtgcagtttcatctgcatagtgtttggttttgtgtgcag |
51112859 |
T |
 |
| Q |
201 |
cgtctgaagcatattcagaggctttatcagtggtggtgctgtccttatctttgtctttgaagccaaggccttcggtgattttctctttggcccactcagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112860 |
cgtctgaagcatattcagaggctttatcagtggtggtgctgtccttatctttgtctttgaagccaaggccttcggtgattttctctttggcccactcagt |
51112959 |
T |
 |
| Q |
301 |
ccatgtctctgc |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51112960 |
ccatgtctctgc |
51112971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University