View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15678_high_8 (Length: 265)
Name: NF15678_high_8
Description: NF15678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15678_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 34732737 - 34732490
Alignment:
| Q |
1 |
cttaactgttaagaatctcactctattattactactgttatcaaatgatgattacaaccagtagtgctaagtttggttgtgttagttttgcagaatttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34732737 |
cttaactgttaagaatctcactctattattactactgttatcaaatgatgattacaaccagtagtgctaagtttggttgtgttagttttgcagaatttat |
34732638 |
T |
 |
| Q |
101 |
ttcaatttttggttatagattcatgttactgttttctcttttcaaaagactttgataataattatttaagtgattttgtcattcaaatgtgtttgtgtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34732637 |
ttcaatttttggttatagattcatgttactgttttctcttttcaaaagactttgataataattatttaagtgattttgtcattcaaatgtgtttgcgtct |
34732538 |
T |
 |
| Q |
201 |
tttttgtctaatcattttctgagatagttaagttttcatgagtgtttt |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34732537 |
tttttgactaatcattttctgagatagttaagttttcatgagtgtttt |
34732490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 34723005 - 34722961
Alignment:
| Q |
180 |
cattcaaatgtgtttgtgtcttttttgtctaatcattttctgaga |
224 |
Q |
| |
|
||||||||||||||||| ||||||||| || ||||| |||||||| |
|
|
| T |
34723005 |
cattcaaatgtgtttgtatcttttttgacttatcatgttctgaga |
34722961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 34665467 - 34665520
Alignment:
| Q |
168 |
aagtgattttgtcattcaaatgtgtttgtgtcttttttgtctaatcattttctg |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||| || |||||| |||| |
|
|
| T |
34665467 |
aagttattttgtcattcaaatgtgtttgtgtctcttttggcttatcattgtctg |
34665520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University