View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1568-INSERTION-1 (Length: 268)
Name: NF1568-INSERTION-1
Description: NF1568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1568-INSERTION-1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 268
Target Start/End: Original strand, 15176378 - 15176638
Alignment:
| Q |
8 |
caaacggcatcatctttatctctttactccccattatatcgaaagtgctattattgataaacctctccggcttaaatgccataggatcatcccaagccga |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15176378 |
caaatggcatcatctttatctctttactccccattatatcgaaagtactattattgataaacctctccggtttaaatgccataggatcatcccaagccga |
15176477 |
T |
|
| Q |
108 |
aaaatctctccctatctcagccaccaagaaattcacagatgcaaaagtaggcaccgaataaccatttaaaacaacctcttctgtcactctatgaggagca |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15176478 |
aaaatctctccctatctccgccaccaagaaattcacagatgcaaaagtaggcaccgaataaccatttaaaacaacctcttcggtcactctatgaggagca |
15176577 |
T |
|
| Q |
208 |
acatagtgtaacggtggatgccgtcttagcccttccaaaatcacagctttaagatatggca |
268 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15176578 |
acatagtgcaacggtggatgacgccttagcccttccaaaattacagctttaagatatggca |
15176638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 2321452 - 2321407
Alignment:
| Q |
8 |
caaacggcatcatctttatctctttactccccattatatcgaaagt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| ||||| |
|
|
| T |
2321452 |
caaacggcatcatctttatctctttactccctataatatcaaaagt |
2321407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University