View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15680_high_12 (Length: 344)
Name: NF15680_high_12
Description: NF15680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15680_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 1 - 329
Target Start/End: Complemental strand, 49584785 - 49584457
Alignment:
| Q |
1 |
actttacgacacacatgtcgtgaaggttttgatactaaacagtcctcctgacttctgttgcgcttctttttgtctagatatccaaatgcgaaagcctccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49584785 |
actttacgacacacatgtcgtgaaggttttgatactaaacagtcctcctgacttctgttgcgcttctttttgtctagatatccaaatgcaaaagcctccg |
49584686 |
T |
|
| Q |
101 |
gaactttctcccgaggtggaattaccgttgcatttttctctagatcaatgagctcaggattggacgcaactttattgaggatttcaaacggagaatcgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584685 |
gaactttctcccgaggtggaattaccgttgcatttttctctagatcaatgagctcaggattggacgcaactttattgaggatttcaaacggagaatcgaa |
49584586 |
T |
|
| Q |
201 |
atattgtacccccttcagcagattcctcgaaaactgtttaactcgagggacaaggaagaccatagaattcttacaaggaacataattataacatctaggt |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584585 |
atattgtacccccttcagcagattccttgaaaactgtttaactcgggggacaaggaagaccatagaattcttacaaggaacataattataacatctaggt |
49584486 |
T |
|
| Q |
301 |
tcctccgagtgccaacctcttgcaagtag |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49584485 |
tcctccgagtgccaacctcttgcaagtag |
49584457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University