View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15681_low_10 (Length: 249)

Name: NF15681_low_10
Description: NF15681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15681_low_10
NF15681_low_10
[»] chr7 (2 HSPs)
chr7 (122-231)||(37920605-37920714)
chr7 (13-47)||(37920495-37920529)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 231
Target Start/End: Original strand, 37920605 - 37920714
Alignment:
122 atctatttttatgtatagaaaaacccttaacctactttttaccaaactattgaacannnnnnnngtacaaactattgaacatttttatgcattataaaaa 221  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||    
37920605 atctatttttacgtatagaaaaacccttaacctactttttaccaaactattgaacattttttttgtacaaactattgaacatttttatgcattataaaaa 37920704  T
222 gtgaaaaaat 231  Q
    ||||||||||    
37920705 gtgaaaaaat 37920714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 47
Target Start/End: Original strand, 37920495 - 37920529
Alignment:
13 aagaatatatctagtccaactccaatgtagatttg 47  Q
    ||||||||||| |||||||||||||||||||||||    
37920495 aagaatatatccagtccaactccaatgtagatttg 37920529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University