View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15681_low_8 (Length: 281)
Name: NF15681_low_8
Description: NF15681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15681_low_8 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 60 - 281
Target Start/End: Complemental strand, 44636292 - 44636071
Alignment:
| Q |
60 |
catgtgtatgccatcatatgtatctatgtagttacataagtattattatttgatgttaactattttgcatgagatccatcacgttatagttatactttgc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44636292 |
catgtgtatgccatcatatgtatctatgtagttacataagtattattatttgatgttaactattttgcatgagatccatcacgttatagttatactttgc |
44636193 |
T |
 |
| Q |
160 |
tatgcacatgaaatgatactccatcttattaccgtatatatggattggagcaaacaaataatcagattactgctgcaaatagacggggttttccccatat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44636192 |
tatgcacatgaaatgatactccatcttattaccgtatatatggattggagcaaacaaataatcagattactgctacaaatagacggggttttccccatat |
44636093 |
T |
 |
| Q |
260 |
ttttatgcaaaacttgcaactt |
281 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44636092 |
ttttatgcaaaacttgcaactt |
44636071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 44636332 - 44636290
Alignment:
| Q |
1 |
tcatgttgcagttacaacacttcatgtgtgctgtgagacacat |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44636332 |
tcatgttgcagttacaacacttcatgtgtgctgtgagacacat |
44636290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University