View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15684_high_14 (Length: 249)
Name: NF15684_high_14
Description: NF15684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15684_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 23 - 121
Target Start/End: Original strand, 44650970 - 44651068
Alignment:
| Q |
23 |
cagagattgtacggctaagatctgttacagcatcttgctgtaacagcgttgaatccagatccgtaatagtgtcattactaatccttttgtcagcaaaag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44650970 |
cagagattgtacggctaagatctgttacagcatcttgctgtaacagcgttgaatccagatcagtaatagtgtcattactaatccttttgtcagcaaaag |
44651068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 188 - 249
Target Start/End: Original strand, 44651137 - 44651198
Alignment:
| Q |
188 |
actgcatagaactttcaatcttagtgaggaataattaacagagacaataaaataaatggaaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44651137 |
actgcatagaactttcaatcttagtgaggaataattaacagagaccataaaataaatggaaa |
44651198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 14523649 - 14523701
Alignment:
| Q |
24 |
agagattgtacggctaagatctgttacagcatcttgctgtaacagcgttgaat |
76 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
14523649 |
agagattgtacggctaagatctgttaaagcatcctgctgtaagagcgttgaat |
14523701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University