View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15685_high_2 (Length: 570)
Name: NF15685_high_2
Description: NF15685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15685_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 1e-82; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 396 - 555
Target Start/End: Complemental strand, 44221458 - 44221299
Alignment:
| Q |
396 |
ataacatacaagttttgcagtcggagaagcagtcaaatagacccgtggaccattcctggttggcattaggctggtggccgacattcactgggaaaccggt |
495 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44221458 |
ataacatacaagttttgcagtcggagaagcagtcaaatagacccgtggaccattcctggttggcattaggctggtggccgacattcaccgggaaaccggt |
44221359 |
T |
|
| Q |
496 |
ggctggtggctggttgtacggttgttggaatttagaaccttgaggattcataactataat |
555 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221358 |
ggctggtggctggttgtacggttgttggaatttagaaccttgaggattcataactataat |
44221299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 11 - 155
Target Start/End: Complemental strand, 44221866 - 44221722
Alignment:
| Q |
11 |
aatgaactaagcaatcacaacaaggagtgtctttgagcatgtattgttgtctcattttgttacggtagatgcatgagtataaacaaccacaacccgtcac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221866 |
aatgaactaagcaatcacaacaaggagtgtctttgagcatgtattgttgtctcattttgttacggtagatgcatgagtataaacaaccacaacccgtcac |
44221767 |
T |
|
| Q |
111 |
acaacaaattaatgtatatagagccccgcttacagcacaagctgc |
155 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44221766 |
acaacaaattaatgtatatagagccccacttacagcacaagctgc |
44221722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 231 - 308
Target Start/End: Complemental strand, 44221636 - 44221559
Alignment:
| Q |
231 |
cttacaagttgatcccttgtcaacaatctcggcaattcgtccaaaggtgatgcatggacaccagtacgttatgcaacc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221636 |
cttacaagttgatcccttgtcaacaatctcggcaattcgtccaaaggtgatgcatggacaccagtacgttatgcaacc |
44221559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University