View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15686_high_12 (Length: 251)
Name: NF15686_high_12
Description: NF15686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15686_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 29 - 235
Target Start/End: Complemental strand, 35328430 - 35328223
Alignment:
| Q |
29 |
ttagaataatgaattgggagtttctgtaacttattgaaattgtgaagatcaattaacttcctctgatcacnnnnnnnnnggataatgtcactctcttctc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35328430 |
ttagaataatgaattgggagtttctgtaacttattgaaattgtgaatatcaattaacttcctctgatcactttttttt-ggataatgtcactctcttctc |
35328332 |
T |
 |
| Q |
129 |
taaataggagtattttgaattattgaagcatatcatccaagagcaagagaggagagca--ggtgtgtgatttcacttggttgagattctcatctagcatc |
226 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35328331 |
taaatacgagtattttgaattattgaagcatatcatccaagagcaagagaggagagcaagtgtgtgtgatttcacttggttgagattctcatctagcatc |
35328232 |
T |
 |
| Q |
227 |
tagcgagtg |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
35328231 |
tagcgagtg |
35328223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University