View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15686_low_5 (Length: 455)
Name: NF15686_low_5
Description: NF15686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15686_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 144 - 438
Target Start/End: Complemental strand, 35951914 - 35951620
Alignment:
| Q |
144 |
ggtcatcatcatcaaataataataagcatgaaattgttcagatgcttgaaactgggcagcaaaatgaaatgcctccattggatgatgatgtggcaatgaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35951914 |
ggtcatcatcatcaaataataataagcatgaaattgttcagatgcttgaaactgggcagcaaaatgaaatgcctccattggatgatgatgtggcaatgaa |
35951815 |
T |
 |
| Q |
244 |
gaaacatctcaaggcatgggcttatgcagttgcaatctcaaatgaacctatttctaaggttcacttgatgaactctcaagtttaactccagtccttttgt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35951814 |
gaaacatctcaaggcatgggcttatgcagttgcaatctcaaatgaacctatttctaaggttcacttgatgaactctcaagtttaactccagtccttttgt |
35951715 |
T |
 |
| Q |
344 |
caaattaattaatgcatcctaatgctatatatgttgcaccattccataagtactattctctctatgtaagggatatgactattttacattatatc |
438 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35951714 |
caaattaattaatgcatcctaatgctatatatgttacaccattccataagtactattctctctatgtaagggatataactattttacattatatc |
35951620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 35952048 - 35951991
Alignment:
| Q |
7 |
gtcgaagaatatcgataacaagaccgcggcgtgccaaaaatcttcatcatcagcagtt |
64 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35952048 |
gtcgcagaatatccataacaagaccgcggcgtgccaaaaatcttcatcatcagcagtt |
35951991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University