View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15686_low_8 (Length: 314)
Name: NF15686_low_8
Description: NF15686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15686_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 49424631 - 49424922
Alignment:
| Q |
1 |
acgaactgcagataaagtaatttatacattattttcattagcacggtcttataattcgatttgnnnnnnnnncttttccctttccaatagctttagtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49424631 |
acgaactgcagataaagtaatttatacattattttcattagtacagtcttataattcgatttgtttttttttcttttccctttccaatagctttagtttt |
49424730 |
T |
 |
| Q |
101 |
cgctaaataatggagttgcatttttgtaaaaattagttaagaaaaatcaattccattctaaaaactgcatttcgtatttggtaaatgcannnnnnnnnag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49424731 |
cgctaaataatggagttgcatttttgtaaaaattagttaagaaaaatcaattccattctaaaaactgcatttcgtatttggtaaatgca-ttttttttag |
49424829 |
T |
 |
| Q |
201 |
gggttggtaaaggcaattttagttaagtttagaatcacgtgtgcatcaatcctttttatttagatttgggacaaactattaaggatgagtgtc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49424830 |
gggttggtaaaggcaattttagttaagtttagaatcacgtgtgcatcaatcctttttatttagatttgggacaaactattaaggatgagtgtc |
49424922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University