View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15687_low_1 (Length: 318)
Name: NF15687_low_1
Description: NF15687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15687_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 8 - 310
Target Start/End: Complemental strand, 26032341 - 26032038
Alignment:
| Q |
8 |
agtgagatgaactaaacttttacgatatgaaaaatcaatttatgaattttgactaaggatgtactcatatttaggatgagacacatcttgaatatgatga |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26032341 |
agtgaaatgaactaaacttttacgatatgaaaaattaatttttgaattttgactaagtatgtactcatatttaggatgagacacatcttgaatatgatga |
26032242 |
T |
 |
| Q |
108 |
tctcaataaagaaactctatagggnnnnnnnttgagctggaagcagccggcaaagaaattttaatctactagtgttaagtttcaaaggccacctaacctc |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26032241 |
tctcaataaagaaactctatagggaaaaaaattgagctggaagcagccggcaaagaaattttaatctactagtgttaagtttcaaaggccacctaacctt |
26032142 |
T |
 |
| Q |
208 |
tagttcaaata-ccatgttatatttttactcttttttaatttctatgtgtgtcccttaattatctgcattgaggtctatatttcctttgagaaaatgtta |
306 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26032141 |
tagttcaaatacccatgttatatttttactcttttttaatttctatgtgtgtcccttaattatctgcattgaggtctatatttcctttgagaaaatgtta |
26032042 |
T |
 |
| Q |
307 |
tgtg |
310 |
Q |
| |
|
|||| |
|
|
| T |
26032041 |
tgtg |
26032038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University