View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15688_high_2 (Length: 379)
Name: NF15688_high_2
Description: NF15688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15688_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 22 - 368
Target Start/End: Complemental strand, 26977603 - 26977257
Alignment:
| Q |
22 |
ctatacatgaccctttaaattctttgtaaaagatcatcaacatctaataccagcaagaattatcatgcaacaagttgatgacaagcaagcaaatcctatt |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
26977603 |
ctatacatgaccctttaaattcttcgtaaaagatgaacaacatctaataccagcaagaattatcatgcaacaagttgatggcgagcaagcaaatcctatt |
26977504 |
T |
|
| Q |
122 |
caagggtcaagaagcacaaactcgtaggctcaaattttcctcactacatgcagcaaaacaagcaagtgggaatggtcaaatcaaaatatactattactat |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26977503 |
caagggtcaagaagcacaaacttgtaggctcaaattttcctcactacatgcagcaaaacaagcaagtgggaatggtcaaatcaaaatatactattactat |
26977404 |
T |
|
| Q |
222 |
attatttactttcataaaaaacaagaacctttttaattcaaacagtgtgttatatactagtaataatagtaccaatagctttcaataatcgagttgcatg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26977403 |
attatttactttcataaaaaacaagaacctttttaattcaaacagtgtgttatatactagtaataatagtaccaatagctttcaataatcgagttgcatg |
26977304 |
T |
|
| Q |
322 |
tgtttcagattaattaaaatatataaatgcaaacatgctgacttcat |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26977303 |
tgtttcagattaattaaaatatataaatgcaaacatgctgacttcat |
26977257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University