View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15688_high_3 (Length: 361)
Name: NF15688_high_3
Description: NF15688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15688_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 120 - 239
Target Start/End: Complemental strand, 24109278 - 24109159
Alignment:
| Q |
120 |
accatctgttatctctactccctaattagattgattccatctttgtttaatttctcgtcttgattgtaattccctacttgtcaatcaatattgcatttta |
219 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24109278 |
accatctgttatctctattccctgattagattgattccatctttgtttaatttctcgtcttgattgtaattccctacttgtaaatcaatattgcatttta |
24109179 |
T |
 |
| Q |
220 |
ttcattttcatccatctgta |
239 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24109178 |
ttcattttcatccatctgta |
24109159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 293 - 334
Target Start/End: Complemental strand, 24108239 - 24108198
Alignment:
| Q |
293 |
acttttgtgtgcctccattgactatccagtgtattaattaca |
334 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24108239 |
acttttgtgtgcctcctttgactatccagtgtattaattaca |
24108198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 293
Target Start/End: Complemental strand, 24108320 - 24108280
Alignment:
| Q |
254 |
tttgattcataacaatcttatattcgg-ttttcgaatttca |
293 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24108320 |
tttgattcataacaatcttatattcggtttttcgaatttca |
24108280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University