View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15688_low_10 (Length: 208)
Name: NF15688_low_10
Description: NF15688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15688_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 117
Target Start/End: Complemental strand, 10360248 - 10360147
Alignment:
| Q |
16 |
ttttcctctagtaatttcctcctttccaaattcaatttggacattgccctaaacaagagttggcttcttcttcctgttttgtcgtttgtaggatcagcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
10360248 |
ttttcctctagtaatttcctcctttccaaattcaatttggacattgccctaaacaagagtttgcttcttcttcctgttttgtcgtttttaggatcaacat |
10360149 |
T |
 |
| Q |
116 |
tg |
117 |
Q |
| |
|
|| |
|
|
| T |
10360148 |
tg |
10360147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University