View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15688_low_3 (Length: 472)
Name: NF15688_low_3
Description: NF15688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15688_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 27056241 - 27056116
Alignment:
| Q |
1 |
aatcaattgtaattaatgctttgcatgaggccaaatgttggtcgagcttggcaagattgggagagacaacaaatttagagagtggaaattgacaaacgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27056241 |
aatcaattgtaattaatgctttgcatgaggccaaatgttggtcaagcttggcaagattgggagagacaacaaatttagagagtggaaattgacaaacgct |
27056142 |
T |
|
| Q |
101 |
acaaa-ggtatccgacatgttgaggc |
125 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
27056141 |
acaaagggtatccgacatgttgaggc |
27056116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University