View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15688_low_7 (Length: 297)
Name: NF15688_low_7
Description: NF15688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15688_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 23 - 285
Target Start/End: Original strand, 54955810 - 54956072
Alignment:
| Q |
23 |
atgcatcaaaaatcaaaatatttgannnnnnnnatataaaataatttattcnnnnnnngaatctttaaaaagtgattgacaaatgctcgttaacag-gac |
121 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||||| | |||| |||||||||| ||| |
|
|
| T |
54955810 |
atgcatcaaaaatcaaaatatttgattttttc--tataaaataatttattctatttttgaatatttaaaaagtgatcggcaaacactcgttaacaaagac |
54955907 |
T |
|
| Q |
122 |
cttttaataaataatgtat-ccatctataaatacatcatttatttattaaataaaaaactttctcttgtcgagacggagcgatgagtagtgtgagagaaa |
220 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54955908 |
cttttactaaataatgtattccatctataaatacatcatttatttattaaataaaaaactttctcttgtcgagacggagcgatgagtagtgtgagagaaa |
54956007 |
T |
|
| Q |
221 |
tcgcttggtagtcctctagataacacgttagattagatctatttgcattgtttccgttcatttca |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54956008 |
tcgcttggtagtcctctagataacacgttagattagatctatttgccttgtttccgttcatttca |
54956072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University