View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1568_low_2 (Length: 319)
Name: NF1568_low_2
Description: NF1568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1568_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 5 - 299
Target Start/End: Complemental strand, 39486779 - 39486485
Alignment:
| Q |
5 |
gacatgcgacagttgcgaccagcacagtttgctaacatgcgcgtcatcaatcactactaactacactgctccatttccttcttcacctcccaaatcacaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39486779 |
gacatgcgacagttgcgaccagcacagtttgctaacatgcgcgtcatcaatcactactaactacactgctccatttccttcttcacctaccaaatcacaa |
39486680 |
T |
|
| Q |
105 |
tttctgttcaattgctccggcgactgtaatgtgaaatgagacgtcgccctgtggcggccattttctccgatcaaatggagcaatcaactaccaaatccca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39486679 |
tttctgttcaattgctccggcgactgtaatgtgaaatgagacgtcgccctgtggcggccattttctccgatcaaatggagaaatcaactaccaaatccca |
39486580 |
T |
|
| Q |
205 |
caattcccgtatcttcttcctcgcttctctctccgcttttttctggcttttactcctctacttccatttcatcatcctcccccaccaacaatcct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39486579 |
caattcccgtatcttcttcctcgcttctctctccgcttttttctggcttttactcctctacttccatttcatcatcctcccccaccaacaatcct |
39486485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University