View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15691_low_11 (Length: 240)
Name: NF15691_low_11
Description: NF15691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15691_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 48 - 237
Target Start/End: Complemental strand, 1001211 - 1001026
Alignment:
| Q |
48 |
tttcatatttttctttgcaacttataggaactcaactatcatactgtaaaagctttcaataccttttgttatagtaatatggctagttctccaaacaact |
147 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1001211 |
tttcatatttttctttgcaacttatcagaagtcaactatcatattataaaagctttaaataccttttgttatagtaatatggctagttctccaaacaact |
1001112 |
T |
 |
| Q |
148 |
aacataatgatataagtttccctgnnnnnnntaatgatataagaataaaatatatagatggcaacttgagtaaatgtaacaggaactgaa |
237 |
Q |
| |
|
||||||||||||||||||||||| ||| | |||||||||||||||||| ||||||| |||||||||||||||| ||||||| |
|
|
| T |
1001111 |
aacataatgatataagtttccct----aaaaaaataaaataagaataaaatatataaatggcaatttgagtaaatgtaacaaaaactgaa |
1001026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University