View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15691_low_14 (Length: 226)
Name: NF15691_low_14
Description: NF15691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15691_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 140
Target Start/End: Original strand, 42462413 - 42462535
Alignment:
| Q |
18 |
ctactattatttccatttacacttgattagatgttgaaataacaagacaaatgcatgggaaatgatagcaactgaagtgttcaccaacgatgctcattca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42462413 |
ctactattatttccatttacacttgattagatgttgaaataacaagacaaatgcatgggaaatgatagcaactgaagtgttcaccaacgatgctcattca |
42462512 |
T |
|
| Q |
118 |
acccaataaaaataaaaacaata |
140 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42462513 |
acccaataaaaataaaaacaata |
42462535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 42462594 - 42462662
Alignment:
| Q |
141 |
tttatagtattcattttcattattcgatttcaacatcactcacaaccgaattgtattttaaactgtctc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42462594 |
tttatagtattcattttcattattcgatttcaacatcactcacaaccgaattgtattttaaactgtctc |
42462662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University