View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15691_low_18 (Length: 204)
Name: NF15691_low_18
Description: NF15691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15691_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 26716859 - 26716970
Alignment:
| Q |
18 |
actaatatcaaatttgatg-cattgttatcagttggaaaataactaaatataaaactgtatgataaatagaaattatataaatttcatgaatagcccatg |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26716859 |
actaatatcaaatttgatgacattgttatcagttggaaaataactaaatataaaactgtatgataaatagaaattatataaatttcatgaatagcccatg |
26716958 |
T |
|
| Q |
117 |
tacaatcctttc |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26716959 |
tacaatcctttc |
26716970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University