View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15692_high_6 (Length: 263)
Name: NF15692_high_6
Description: NF15692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15692_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 7222752 - 7222496
Alignment:
| Q |
1 |
ttttgtatttcttttagctggttt-tatttgctactcctttcacaacgcaatattaaaattgtaaatgttttttgctctaaaaaa---tcataaaactaa |
96 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7222752 |
ttttgtctttcttttagctggtttgtatttgctactcctttcacaacgcaatattaaaattgtaaatgttttttgctctaaaaaaaaatcataaaactaa |
7222653 |
T |
|
| Q |
97 |
catccgagtgaagtagcatctatgaaggataattgactttgtgaatgaagccaatcaattgcttcaacttgctcctcgataggaacctccactttcaaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
7222652 |
catccgagtgaagtagcatctatgaaggataattgactttgcaaatgaagccaatcaattgtttcaacttgctcctcgagaggaacctccactctcaaaa |
7222553 |
T |
|
| Q |
197 |
ttagttcaaaatggagagtcttctttcagctctgaaatggcctttttgctccctatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
7222552 |
ttagttcaaaatggagagtcttctttaagctctgaaatggcctttttgctccttatg |
7222496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 29264747 - 29264802
Alignment:
| Q |
134 |
tttgtgaatgaagccaatcaattgcttcaacttgctcctcgataggaacctccact |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29264747 |
tttgtgaatgaagccaatcaattgcttcaacttgctcctcaataggaacctccact |
29264802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University