View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15692_low_6 (Length: 288)
Name: NF15692_low_6
Description: NF15692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15692_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 23888247 - 23888522
Alignment:
| Q |
1 |
agtttctttactagaatattgagtgatatgctcttaaggcaggaggatctatctatggctcttgcattagccagcacatggaccatgttcattgcatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23888247 |
agtttctttactagaatattgagtgatatgctcttaaggcaggaggatctatctatggctcttgcattagccagcacatggaccatgttcattgcatttg |
23888346 |
T |
 |
| Q |
101 |
gaagtttagtgtgtattgggccaatatcttataccgttggcatggcttatcaaaatgccttcagttcaggtttatcatatatatagtagccagccagctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23888347 |
gaagtttagtgtgtattgggccaatatcttacaccgttggcatggcttatcaaaatgccttcagttcaggtttatcatatatatagtagccagccagctg |
23888446 |
T |
 |
| Q |
201 |
cattcgggtttctggcctcggtgaatagcattatgttcattgtgttgtgtcagcttcaggtaaaaatctctctgct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23888447 |
cattcgggtttctggcctcggtgaatagcattatgttcattgtgttgtgtcagcttcaggtaaaaatctctctgct |
23888522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University