View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15694_high_11 (Length: 381)
Name: NF15694_high_11
Description: NF15694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15694_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 10 - 344
Target Start/End: Complemental strand, 441803 - 441470
Alignment:
| Q |
10 |
ttatactaaattctacgatttgaacttgaaaatttattacccaaaaaacgaaaacatttcagatttaaacaagttgagttcagttggacccgatctcgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
441803 |
ttatactaaattctacgatttgaacttgaacatttattacccaaaaa-cgaaaacatttcagatttgaacaagttgagttcagttggacccgatctcgaa |
441705 |
T |
 |
| Q |
110 |
taaattgaaataaaataaaatttagcttcatttggattatcgaatcagattgaatgggtcacatgaaccctaaaacatctttaattgagaagtctttttc |
209 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
441704 |
taaattgaaataaaatagaagttagcttcatttggattatcgaatcagattgaatgggtcacctgtaccctaaaacatctttaattgagaagtctttttc |
441605 |
T |
 |
| Q |
210 |
aaaatttagattttggtataaaggtaacacaaaactcatgtttagttgtgttcatgggtgtggatcggcatacaaacctagtgagtcaacccgactcaac |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
441604 |
aaaatttagattttggtataaaggtaacacacaactcatgtttagttgtgttcatgggtgtggatcggcatacaaacctagtgagtcaacccgactcaac |
441505 |
T |
 |
| Q |
310 |
ccacattacctaagcctaattatttatggatctat |
344 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
441504 |
ccacattgcctaagcctaattatttatggatctat |
441470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University