View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15694_high_15 (Length: 359)
Name: NF15694_high_15
Description: NF15694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15694_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 11 - 340
Target Start/End: Original strand, 32169236 - 32169565
Alignment:
| Q |
11 |
cacagacacagcgagtacgattcgtgttccttcttccgccacagatagcctcaatctcacgcttctccaactcaaatgattatgagattcaaataggtgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169236 |
cacagacacagcgagtacgattcgtgttccttcttccgccacagatagcctcaatctcacgcttctccaactcaaatgattatgagattcaaataggtgt |
32169335 |
T |
 |
| Q |
111 |
tctgtgtttggtgctttcacccttcaacaatggcattgctagctccacaacgcacgtgcctcatcttcactctcttcaccgttttcttactttcatcttc |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169336 |
tctgtgtttggtgttttcacccttcaacaatggcattgctagctccacaacgcacgtgcctcatcttcactctcttcaccgttttcttactttcatcttc |
32169435 |
T |
 |
| Q |
211 |
tttaagctcagcaacacccaccacagcttgcaaattcagttttcgcgacggaaacaagctttacaattataccctctcttctccaattcgtaacttccct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169436 |
tttaagctcagcaacacccaccacagcttgcaaattcagttttcgcgacggaaacaagctttacaattataccctctcttctccaattcgtaacttccct |
32169535 |
T |
 |
| Q |
311 |
catggcattctcagcgaagacgggtcctct |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32169536 |
catggcattctcagcgaagacgggtcctct |
32169565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University