View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15694_high_21 (Length: 276)
Name: NF15694_high_21
Description: NF15694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15694_high_21 |
 |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0289 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0288 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 92 - 265
Target Start/End: Complemental strand, 18042 - 17867
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacacttttt-ctttggtcccgtgaccatattagaatttctcttacctctattacagtaacacgggttagaagaaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18042 |
tacttctttatgtgtgtgtgaccaaacacttttttctttggtcccgtgaccatattagaatttctcttacctctattacagtaacacgggttagaagaaa |
17943 |
T |
 |
| Q |
191 |
gaaggg-nnnnnnnngacagtatcaaataaggtgtgactggatggtggttgttgggatgagttttggtttgatatt |
265 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17942 |
gaagggaaaaaaaaagacagtatcaaataaggtgtgactggatggtggttgttgggatgagttttggtttgatatt |
17867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 93 - 156
Target Start/End: Original strand, 30208316 - 30208379
Alignment:
| Q |
93 |
acttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30208316 |
acttctttatgtgtgtgtgaccaaacactttttctttggtcctgtgaccatattagaatttctc |
30208379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 1162106 - 1162045
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
1162106 |
ttctttatgtgtgtgtgaccaaacactttttctttagtcctatgaccatataagaatttctc |
1162045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 35179276 - 35179338
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
35179276 |
tacttctttatgcgtgtgtgaccaaacactttttctttgatcc--tgaccatattagaatttctc |
35179338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 95 - 155
Target Start/End: Complemental strand, 31333151 - 31333091
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttct |
155 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
31333151 |
ttctttatgtgtgtgtgaccaaacactatttctttgatcatgtgaccatattagaatttct |
31333091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 155
Target Start/End: Original strand, 5594899 - 5594962
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttct |
155 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| ||| |||||||||||| ||||||| |
|
|
| T |
5594899 |
tacttctttatatgtgtgtgactaaacactttttctttgatcctgtgaccatattaaaatttct |
5594962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 156
Target Start/End: Complemental strand, 40719887 - 40719821
Alignment:
| Q |
92 |
tacttctttatgtgtgt--gtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
40719887 |
tacttctttatgtgtgtatgtgaccaaacactttttctttggtcatgcgaccatattagaatttctc |
40719821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 92 - 159
Target Start/End: Original strand, 34514561 - 34514628
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctta |
159 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||| ||||| |||||| ||||||||||| |
|
|
| T |
34514561 |
tacttttttatgtgtgtgtgaccaaacactatttgtttggtcttgtgactatattaaaatttctctta |
34514628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 95 - 156
Target Start/End: Original strand, 36132793 - 36132854
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||| | |||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
36132793 |
ttctttatgtgtgtataaccaaacactttttatttggccatatgaccatattagaatttctc |
36132854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 34173539 - 34173603
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||| ||| |||||||| ||| |||||||| |
|
|
| T |
34173539 |
tacttgtttatatgtgtgtgaccaaacactttttgtttagtcttgtgaccatgttaaaatttctc |
34173603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 39402004 - 39401954
Alignment:
| Q |
107 |
gtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| |||||| ||||||||| |
|
|
| T |
39402004 |
gtgtgaccaaacactttttctttgatcatgtgacgatattaaaatttctct |
39401954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 42921493 - 42921545
Alignment:
| Q |
104 |
tgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||||| || ||| |||||||| |
|
|
| T |
42921493 |
tgtgtgtgatcaaacactttttctttgatcctgtgactatgttataatttctc |
42921545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 92 - 159
Target Start/End: Complemental strand, 46550696 - 46550629
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctta |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46550696 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcttgtgaccatattagaatttctctta |
46550629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 47541795 - 47541737
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
47541795 |
tttatgtgtgtgtgaccaaacactttttctttgatctcgtgaccatattagaatttctc |
47541737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 92 - 157
Target Start/End: Complemental strand, 15827116 - 15827051
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||| |||||||| |||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
15827116 |
tacttcttaatgtgtgtatgaccaaacactatttctttagtcccgtaaccatattagaatttctct |
15827051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 156
Target Start/End: Complemental strand, 41464786 - 41464731
Alignment:
| Q |
101 |
atgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| || ||||||||| |||||||| |
|
|
| T |
41464786 |
atgtgtgtgtgaccaaacactatttctttagtcctgtaaccatattataatttctc |
41464731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 47732457 - 47732508
Alignment:
| Q |
105 |
gtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||| |||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
47732457 |
gtgtgtgatcaaacaatttttctttgatcctgtgaccatattagaatttctc |
47732508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 36364659 - 36364605
Alignment:
| Q |
102 |
tgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||||||| ||||| |||| || ||||||||||||| |||||||| |
|
|
| T |
36364659 |
tgtgtgtgtgaccaaacattttttatttgatcacgtgaccatattaaaatttctc |
36364605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 95 - 157
Target Start/End: Complemental strand, 39503493 - 39503431
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| || |||||||||||| ||||||||| |
|
|
| T |
39503493 |
ttctttatgtgtgtgtgatcaaacactttttatttaatcatgtgaccatattaaaatttctct |
39503431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 95 - 156
Target Start/End: Original strand, 17056733 - 17056793
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| ||||||| |||||||| |||||||||||| |
|
|
| T |
17056733 |
ttctttatgtgtgtatgaccaaacac-ttttatttggtcgtgtgaccattttagaatttctc |
17056793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 157
Target Start/End: Complemental strand, 41844233 - 41844168
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| | |||| |||| ||| ||||||||||||| |
|
|
| T |
41844233 |
tacttgtttatgtgtgtgtgaccaaatactttttgtcgggtcttgtgaacatgttagaatttctct |
41844168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 13)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 92 - 159
Target Start/End: Original strand, 24241594 - 24241661
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctta |
159 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24241594 |
tacttttttatgtgtgtgtgaccaaatactttttctttggtcctgtgaccatattagaatttctctta |
24241661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 92 - 158
Target Start/End: Original strand, 41942896 - 41942962
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
41942896 |
tacttctttatgtgtgtatgaccaaacactttatctttggtcgtgtgaccatattagaatttctctt |
41942962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 98 - 157
Target Start/End: Original strand, 16253152 - 16253211
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||| |
|
|
| T |
16253152 |
tttatgtgtgtgtgaccaaacactttttctttgatcatgtgatcatattagaatttctct |
16253211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 93 - 156
Target Start/End: Complemental strand, 34773410 - 34773347
Alignment:
| Q |
93 |
acttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
34773410 |
acttctttttgtatgtgtgatcaaacactttttctttggtcctgtaaccatattagaatttctc |
34773347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 92 - 157
Target Start/End: Original strand, 8971545 - 8971610
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
||||| ||||||| ||| ||||| |||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8971545 |
tacttatttatgtatgtatgaccgaacactttttttttggtcctgtgaccatattagaatttctct |
8971610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 98 - 155
Target Start/End: Complemental strand, 15390459 - 15390402
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttct |
155 |
Q |
| |
|
||||||||| |||||||||||||| ||| ||||||||||||||||||||||| ||||| |
|
|
| T |
15390459 |
tttatgtgtatgtgaccaaacactatttgtttggtcccgtgaccatattagactttct |
15390402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 48506795 - 48506859
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||| ||||||||| |||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
48506795 |
tacttctttatatgtgtgtgatcaaacactatttctttagtcaggtgaccatattagaatttctc |
48506859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 157
Target Start/End: Complemental strand, 7101337 - 7101275
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||| || ||| ||||| ||||||||||||| |
|
|
| T |
7101337 |
ttctttatatgtgtgtgaccaaacactttttatttgatcacgtaaccatgttagaatttctct |
7101275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 21356922 - 21356971
Alignment:
| Q |
108 |
tgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
21356922 |
tgtgaccaaacactatttctttggtctcgtggccatattagaatttctct |
21356971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 152
Target Start/End: Original strand, 26764620 - 26764674
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatt |
152 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| | ||||||||||||||||| |
|
|
| T |
26764620 |
tttatgtgtgtgtgaccaaacactatttgtttggccttgtgaccatattagaatt |
26764674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 47370099 - 47370041
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| | |||||||| ||||| |||||| |
|
|
| T |
47370099 |
tttatgtgcgtgtgaccaaacactttttgtttgggcttgtgaccatgttagagtttctc |
47370041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 98 - 143
Target Start/End: Complemental strand, 8971481 - 8971436
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccat |
143 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
8971481 |
tttatatgtgtgtgaccaaatactttttctttggtcgtgtgaccat |
8971436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 45382797 - 45382833
Alignment:
| Q |
122 |
ttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
45382797 |
ttttctttgatcctgtgaccatattagaatttctctt |
45382833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 92 - 157
Target Start/End: Original strand, 36400972 - 36401037
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
36400972 |
tacttctttatgtgtgtgtgtccaaacactttttctttagtcctgtgaccatattagaatttctct |
36401037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 95 - 156
Target Start/End: Original strand, 37721568 - 37721629
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
37721568 |
ttctttatgtgtgtgtgaccaaacactttttctttagtctcgtgaccatattagaatttctc |
37721629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 3870146 - 3870208
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3870146 |
tacttctttatgtg--tgtgaccaaacactttttctttggtcctgtgaccatattagaatttctc |
3870208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 34480111 - 34480055
Alignment:
| Q |
100 |
tatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34480111 |
tatgtgtttgtgaccaaacactttttctttggtcctgtgaccatattagaatttctc |
34480055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 30706132 - 30706074
Alignment:
| Q |
102 |
tgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctcttac |
160 |
Q |
| |
|
|||||||||||||||||||||||| |||| || |||||||||||| |||||||||||| |
|
|
| T |
30706132 |
tgtgtgtgtgaccaaacactttttatttgatcatgtgaccatattaaaatttctcttac |
30706074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 98 - 143
Target Start/End: Original strand, 29685524 - 29685569
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29685524 |
tttatgtgtgtgtgaccaaacactttttctttggtcatgtgaccat |
29685569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 157
Target Start/End: Original strand, 9009105 - 9009164
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
||||||| | |||||||||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
9009105 |
tttatgtctatgtgaccaaacactatttgtttggtcttgtgaccatattagaatttctct |
9009164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 96 - 153
Target Start/End: Complemental strand, 3949306 - 3949249
Alignment:
| Q |
96 |
tctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaattt |
153 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| |||| ||||||||||| ||||| |
|
|
| T |
3949306 |
tctttatgtatgtgtgaccaaacattttttctttaatcccatgaccatattataattt |
3949249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 28733778 - 28733717
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaattt |
153 |
Q |
| |
|
||||| || |||| ||| |||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
28733778 |
tacttattcatgtatgtttgaccaaacactatttctttgatcatgtgaccatattagaattt |
28733717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 38879633 - 38879697
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtc--ccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||| || |||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38879633 |
tacttctttatgtgtatg--accaaacattttttctttggtcatatgtgaccatattagaatttctc |
38879697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 106 - 158
Target Start/End: Original strand, 25199073 - 25199125
Alignment:
| Q |
106 |
tgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25199073 |
tgtgtgaccaaacactttttctttggtcctgtgaccatattagaatttctctt |
25199125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 98 - 156
Target Start/End: Original strand, 2008522 - 2008580
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
2008522 |
tttatgtgtgtgtggccaaacactatttctttggtcctgtgaccatattagaatttctc |
2008580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 155
Target Start/End: Complemental strand, 22831166 - 22831103
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttct |
155 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| ||| |||||||||||| ||||||| |
|
|
| T |
22831166 |
tacttctttatatgtgtgtgactaaacactttttctttgatcctgtgaccatattaaaatttct |
22831103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 45805513 - 45805455
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
45805513 |
tttatgtgtatgtgaccaaacactttttatttggtcatgtgaccatattagaatttctc |
45805455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 101 - 156
Target Start/End: Original strand, 22220334 - 22220389
Alignment:
| Q |
101 |
atgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
22220334 |
atgtgtgtgtgtccaaatactttttctttggtcctgtgaccatattaaaatttctc |
22220389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 1994838 - 1994781
Alignment:
| Q |
99 |
ttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1994838 |
ttatgtgtctgtgaccaaatactatttctttggtcatgtgaccatattagaatttctc |
1994781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 92 - 157
Target Start/End: Complemental strand, 26466321 - 26466256
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
26466321 |
tacttctttatgtgtgtgtgaccaaatttttttttttttatcctgtgaccatattagaatttctct |
26466256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 142
Target Start/End: Complemental strand, 26466231 - 26466181
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgacca |
142 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
26466231 |
tacttttttatgtgtgtgtgaccaaacacttttttttttctcctgtgacca |
26466181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 39170957 - 39170903
Alignment:
| Q |
104 |
tgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
|||||||||||||||| | ||| |||| || ||||||||||||||||||||||| |
|
|
| T |
39170957 |
tgtgtgtgaccaaacattatttatttgatcttgtgaccatattagaatttctctt |
39170903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 34060954 - 34061002
Alignment:
| Q |
108 |
tgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||||| |||||||||||| |
|
|
| T |
34060954 |
tgtgaccaaacactatttgtttggtcttgtgaccatgttagaatttctc |
34061002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 95 - 157
Target Start/End: Original strand, 34998648 - 34998710
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
34998648 |
ttctttatgtgtgtgtgaccaaatactttttctttgatcatgtgaccatattagaatttctct |
34998710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 30783473 - 30783412
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
30783473 |
ttctttatgtgtgtgtgaccaaacactttttatttggtcatgtgaccattttagaatttctc |
30783412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 45627401 - 45627340
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
45627401 |
ttctttatgtgtgtgtgaccaaacagtttttatttggtcatgtgaccattttagaatttctc |
45627340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 157
Target Start/End: Original strand, 32677063 - 32677125
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||| |||||||||||||||| ||||| |||| || |||||||||||||||||||||| |
|
|
| T |
32677063 |
ttctttatatgtgtgtgaccaaacattttttatttgatcatgtgaccatattagaatttctct |
32677125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 95 - 158
Target Start/End: Original strand, 46023248 - 46023311
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
||||||||| |||| |||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
46023248 |
ttctttatgcgtgtatgaccaaacattttttatttggtcatctgaccatattagaatttctctt |
46023311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 98 - 129
Target Start/End: Complemental strand, 40076678 - 40076647
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttcttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40076678 |
tttatgtgtgtgtgaccaaacactttttcttt |
40076647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 98 - 153
Target Start/End: Complemental strand, 46910291 - 46910236
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaattt |
153 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
46910291 |
tttatgtgtttgtgatcaaacactttttctttagtcttgtgatcatattagaattt |
46910236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 8541547 - 8541609
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||| | ||||||||| |||||||| |
|
|
| T |
8541547 |
tacttctttatgtg--tgtgaccaaacactatttctttgatcctataaccatattaaaatttctc |
8541609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 95 - 158
Target Start/End: Complemental strand, 20524592 - 20524529
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| || |||| |||||||||||||||||| |
|
|
| T |
20524592 |
ttctttatgtgtgtgtgaccaaacactttttatttgatcatgtgatcatattagaatttctctt |
20524529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 98 - 157
Target Start/End: Complemental strand, 37872187 - 37872128
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
37872187 |
tttatgtgtgtgtgaccaaatactttttctttggtcctctgatcatattagaatttctct |
37872128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 95 - 158
Target Start/End: Original strand, 10719866 - 10719929
Alignment:
| Q |
95 |
ttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||| ||||||||| || |||||||||| |
|
|
| T |
10719866 |
ttctttatgtgtttgtgaccaaacactttttatttggtcatgtgaccataataaaatttctctt |
10719929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 98 - 156
Target Start/End: Original strand, 16778259 - 16778317
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
16778259 |
tttatgtgtgtatgaccaagcactttttatttggtcctgtggccatattagaatttctc |
16778317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 23145987 - 23145929
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
23145987 |
tttatgtgtatgtgaccaaatactttttctttgatcctatgaccatattagaatttctc |
23145929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 20654519 - 20654461
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||||||| ||| ||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
20654519 |
tttatgtgtgtttgatgaaacactttttatttggtcatgtgaccatattagaatttctc |
20654461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 93 - 153
Target Start/End: Complemental strand, 22472143 - 22472083
Alignment:
| Q |
93 |
acttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaattt |
153 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
22472143 |
acttgtttatgtgtgtgtgagcaaacactatttgtttggtgttgtgaccatattagaattt |
22472083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 96 - 156
Target Start/End: Original strand, 42285289 - 42285349
Alignment:
| Q |
96 |
tctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
42285289 |
tctttatacgtgtgtgatcaaacactttttctttggttctatgaccctattagaatttctc |
42285349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 155
Target Start/End: Complemental strand, 21239045 - 21239003
Alignment:
| Q |
113 |
ccaaacactttttctttggtcccgtgaccatattagaatttct |
155 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
21239045 |
ccaaacactttttgtttggtcttgtgaccatattagaatttct |
21239003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 98 - 143
Target Start/End: Complemental strand, 16778189 - 16778144
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccat |
143 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||| |||||||| |
|
|
| T |
16778189 |
tttatgtgtgtgtgaccaaacacttttcatttgatcctgtgaccat |
16778144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 105 - 133
Target Start/End: Original strand, 34849571 - 34849599
Alignment:
| Q |
105 |
gtgtgtgaccaaacactttttctttggtc |
133 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34849571 |
gtgtgtgaccaaacactttttctttggtc |
34849599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 92 - 158
Target Start/End: Original strand, 994864 - 994930
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctctt |
158 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
994864 |
tacttgtttatgtgtgtgtgaccaaacactatttatttggtcttgtgaccatgttagaatttctctt |
994930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 26606207 - 26606271
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || ||| |||||||| |||||||||||| |
|
|
| T |
26606207 |
tacttgtttatgtgtgtgtgaccaaacactttttgttcggtattgtgaccatgttagaatttctc |
26606271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 92 - 157
Target Start/End: Original strand, 7080270 - 7080335
Alignment:
| Q |
92 |
tacttctttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
||||||||||| | |||||||||||| | ||| | ||||||| |||||||||||||||||||||| |
|
|
| T |
7080270 |
tacttctttatctatgtgtgaccaaatagtttctttttggtcatgtgaccatattagaatttctct |
7080335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 106 - 153
Target Start/End: Complemental strand, 2141222 - 2141175
Alignment:
| Q |
106 |
tgtgtgaccaaacactttttctttggtcccgtgaccatattagaattt |
153 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
2141222 |
tgtgtgaccaaacactttttctttgatcatatgaccatattagaattt |
2141175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 25965 - 26017
Alignment:
| Q |
104 |
tgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctc |
156 |
Q |
| |
|
|||||||| |||||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
25965 |
tgtgtgtgcccaaacacttttcctatggtcatgtgaccatattagaatttctc |
26017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 35498 - 35548
Alignment:
| Q |
107 |
gtgtgaccaaacactttttctttggtcccgtgaccatattagaatttctct |
157 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| |||||| ||||||||| |
|
|
| T |
35498 |
gtgtgaccaaacactttttctttgatcatgtgacgatattaaaatttctct |
35548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0289 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0289
Description:
Target: scaffold0289; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 98 - 155
Target Start/End: Original strand, 12386 - 12443
Alignment:
| Q |
98 |
tttatgtgtgtgtgaccaaacactttttctttggtcccgtgaccatattagaatttct |
155 |
Q |
| |
|
||||||||| ||||||||| ||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
12386 |
tttatgtgttggtgaccaaatactttttgtttggtcttgtgaccatgttagaatttct |
12443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University