View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15694_high_24 (Length: 239)
Name: NF15694_high_24
Description: NF15694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15694_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 33113061 - 33113210
Alignment:
| Q |
35 |
ggaattaatttttaatagtcggtttagtaaaaatattgatcatctttatcttcttttcttgtttatcggtgatcatgggaagaccgttacggaaaatttt |
134 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33113061 |
ggaattaaattttaatagtcggtttagtaaaaatattgatcatctttatcttcttttcttgtttattggtgatcatgggaagaccgttacggaaaatttt |
33113160 |
T |
 |
| Q |
135 |
aattaaaaagattaacatgcgaagattctcttttatttattggataatac |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33113161 |
aattaacaagattaacatgcgaagattctcttttatttattggataatac |
33113210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University