View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15694_high_29 (Length: 206)
Name: NF15694_high_29
Description: NF15694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15694_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 23991995 - 23992180
Alignment:
| Q |
1 |
ccaaaaccatgaatccatgaaactaacagggatgaagggtgtcaaagaagaacgagagtgatcggaaacgaacatggtcattatttcacccttctatctc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23991995 |
ccaacaccatgaatccatgaaactaacagggatgaagggtgtcaa-gaagaacgag--tgaccggaaacgaacatggtcattatttcacccttctatctc |
23992091 |
T |
|
| Q |
101 |
aaattttaaatatttctcttacttgattaattcagtgtaaaatctatgtcacaaaggtgaactcaaacatcttcagccaaatagtttat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23992092 |
aaattttaaatatttctcttacttgattaattcagtgtaaaatctatgtcacaaaggtgaactcaaacatcttcagtcaaatagtttat |
23992180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University