View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15694_low_20 (Length: 300)
Name: NF15694_low_20
Description: NF15694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15694_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 43862046 - 43862325
Alignment:
| Q |
1 |
ttaatcaatcttgcaaggaacaagggaaagggtatgatccctctgacgatgatgatgacgacgacggagatgacgacattggaggtagaaatgttaatga |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
43862046 |
ttaatcaatattgcaaggaacaagggaaagggtatgatccctctgacgacgatgatgatgacgaggacgatgac---attggaggtagaaatgttaatga |
43862142 |
T |
|
| Q |
101 |
tgttgcaggtagaaattaattaacaatattatgatccttgtacttgaaaaacattctttagatgtcatggaatttagcatggatcgatgaaaattaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43862143 |
tgttgcaggtagaaattaattaacaatattatgatccttgtacttaaaaaacattctttagatgtcatggaatt-agcatggatcgatgaaaattaattt |
43862241 |
T |
|
| Q |
201 |
gaataatgttgattgtacttttgcagtttgatgaaactagcttgctgttcaggcatgcatgcagagattgaccagcctttaatc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43862242 |
gaataatgttgattgtacttttgcagtttgatgaaactagctagctgttcaggcatgcatgcagagattgaccagcctttaatc |
43862325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University