View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15695_high_5 (Length: 228)
Name: NF15695_high_5
Description: NF15695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15695_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 29570359 - 29570173
Alignment:
| Q |
1 |
ttgttttagtcgctgggatgnnnnnnnatccccgttgctgttttgtggtctgttgtgtggccctaaggaatgttttggctgtgaggtttacggttatttc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29570359 |
ttgttttagtcgctgggatgtttttttatccccttagctgttttgtggtctgttgtgtggccctaaggagtgttttggctgtgaggtttacggttatttc |
29570260 |
T |
 |
| Q |
101 |
ggtgccttttgtatttttgtcttgtggctgcgagtttttgttgttgccccttgcacactcccgtcatgaataaaatttgctgtttct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29570259 |
ggtgccttttgtatttttgtcttgtggctgcgagtttttgttgttgcaccttgcacactcccgtcatgaataaaatttgctgtttct |
29570173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University