View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15695_low_9 (Length: 224)
Name: NF15695_low_9
Description: NF15695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15695_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 34261106 - 34260909
Alignment:
| Q |
18 |
aatataatgatgatggatggacggcggcattctgtcgatttaccgatttctaaggctcttgtagcattgaggagagtcaggtcattgaaggatccatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34261106 |
aatataatgatgatggatggacggcggcattctgtcgatttaccgatttctaaggctcttgtagcattgaggagagtcaggtcattgaaggatccatcaa |
34261007 |
T |
 |
| Q |
118 |
ctaattctgtgaccaatcattctcctttgattgacaacttacattgggaaaacagttctggcaatggttctttgatgtttccagatgcctttgcttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
34261006 |
ctaattctgtgaccaatcattctcctttgattgacaacttacattgggaaaacagtactggcaatggttctttgatgtttccagatgcttttgattct |
34260909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 118
Target Start/End: Complemental strand, 43113308 - 43113218
Alignment:
| Q |
28 |
tgatggatggacggcggcattctgtcgatttaccgatttctaaggctcttgtagcattgaggagagtcaggtcattgaaggatccatcaac |
118 |
Q |
| |
|
|||||||||| || |||||||||| ||| | || |||||||| |||||||||||||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
43113308 |
tgatggatggtaggaggcattctgttgatgtgcctatttctaaaactcttgtagcattgaggagagttaggtcattgagggatccttcaac |
43113218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University