View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15696_low_14 (Length: 376)
Name: NF15696_low_14
Description: NF15696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15696_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 19 - 366
Target Start/End: Complemental strand, 6214137 - 6213789
Alignment:
| Q |
19 |
gataataagataactaacttaactaactcttcactttatagtttatttattcacttatctatgtatctatt-gtgtatcttaacagaatggtgttcgagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6214137 |
gataataagataactaacttaactaactcttcactttatagtttatttattcacttatctatgtatctatttgtgtatcttaacagaatggtgttcgagg |
6214038 |
T |
|
| Q |
118 |
atttatgttagatatgtatgattttcaaaacgatgtatggttgtgtcattctactggaggcaaatgtttcaacttcagttcattcgtaagtgcgtggctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6214037 |
atttatgttagatatgtatgattttcaaaacgatgtatggttgtgtcattctactggaggcaaatgtttcaacttcagttcattcgtaagtgcgtggctc |
6213938 |
T |
|
| Q |
218 |
tactatctgcttatattattacttcatcaatcattaatgacataacataaactttggggtgtttggttgattttgtaacatccatttgtctatgtctatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6213937 |
tactatctgcttatattattacttcatcaatcattaatgacataacataaactttggggtgtttggttgattttgtaacatccatttgtctatgtctatc |
6213838 |
T |
|
| Q |
318 |
aatgatcggcagatacctgcagtaaacgcgcttagggacatgcgttcat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6213837 |
aatgatcggcagatacctgcagtaaacgcgcttagggacatgcgttcat |
6213789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University