View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15696_low_16 (Length: 362)
Name: NF15696_low_16
Description: NF15696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15696_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 2e-99; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 165 - 352
Target Start/End: Complemental strand, 49438008 - 49437821
Alignment:
| Q |
165 |
gggctcgactattgatagaagactacatgtccagaaaaattgggaggacccaaaatttgttccgcaatgcctttcactacacctcaaaacttgcatattt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49438008 |
gggctcgactattgatagaagactacatgtccagaaaaattggaaggacccaaaatttgttccgcaatgcctttcactacacctcaaaacttgcatattt |
49437909 |
T |
|
| Q |
265 |
cagaatttcataggccaacagggtgagcttatgtcaacaatatatattctgaagaatgcaagagttttgcaaacaatgtcaatctgtg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437908 |
cagaatttcataggccaacagggtgagcttatgtcaacaatatatattctgaagaatgcaagagttttgcaaacaatgtcaatctgtg |
49437821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 49438167 - 49438075
Alignment:
| Q |
1 |
caactctaattggaatttgttggtgcaagtgctcaatcattgccctaagcttgaaaaccttgagctagatgaggtttgttaagtttagggatc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49438167 |
caactctaattggaatttgttggtgcaagtgctcaatcattgccctaagcttgaaaaccttgagctagatgaggtttgttaagtttagggatc |
49438075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 338
Target Start/End: Complemental strand, 17641278 - 17641140
Alignment:
| Q |
200 |
aaaattgggaggacccaaaatttgttccgcaatgcctttcactacacctcaaaacttgcatatttcagaatttcataggccaacagggtgagcttatgtc |
299 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||| ||||||| |||| ||||| | ||| || |||||||||||| | || |||||| | | |
|
|
| T |
17641278 |
aaaattgggtggacccaatatttgttccgcaatgtttttcattacaccttaaaatttgcaaagttctaaacttcataggccaagaaggcgagcttctatt |
17641179 |
T |
|
| Q |
300 |
aacaatatatattctgaagaatgcaagagttttgcaaac |
338 |
Q |
| |
|
||| | | |||||||||||||||| |||||||||||| |
|
|
| T |
17641178 |
ggcaagaaacattctgaagaatgcaaaagttttgcaaac |
17641140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 43359726 - 43359814
Alignment:
| Q |
1 |
caactctaattggaatttgttggtgcaagtgctcaatcattgccctaagcttgaaaaccttgagctagatgaggtttgttaagtttagg |
89 |
Q |
| |
|
||||| ||||||| |||||| || ||||||||||||| ||||||||| ||| |||| ||||||| | |||||||||||||||||| |
|
|
| T |
43359726 |
caactataattggcgtttgttagtacaagtgctcaatccttgccctaaccttcaaaatgttgagcttagtcaggtttgttaagtttagg |
43359814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 90
Target Start/End: Original strand, 49415752 - 49415840
Alignment:
| Q |
2 |
aactctaattggaatttgttggtgcaagtgctcaatcattgccctaagcttgaaaaccttgagctagatgaggtttgttaagtttaggg |
90 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| || ||||| | ||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
49415752 |
aactctaattggcatttgttggcacaagtgctcaaccactgccccagccttcaaaatgttgagcttagtgaggtttgttaagtttaggg |
49415840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 57
Target Start/End: Complemental strand, 49426813 - 49426758
Alignment:
| Q |
2 |
aactctaattggaatttgttggtgcaagtgctcaatcattgccctaagcttgaaaa |
57 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||||||||||||| ||| |||| |
|
|
| T |
49426813 |
aactctaactggcatttgttggcacaagtgctcaatcattgccctaaccttcaaaa |
49426758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 302 - 336
Target Start/End: Original strand, 43362355 - 43362389
Alignment:
| Q |
302 |
caatatatattctgaagaatgcaagagttttgcaa |
336 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43362355 |
caatatatattgtgaagaatgcaagagttttgcaa |
43362389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 306 - 348
Target Start/End: Complemental strand, 49445374 - 49445332
Alignment:
| Q |
306 |
atatattctgaagaatgcaagagttttgcaaacaatgtcaatc |
348 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
49445374 |
atatattttgaagaatgcaagagttttgcaaaccatgacaatc |
49445332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 204 - 240
Target Start/End: Original strand, 37419392 - 37419428
Alignment:
| Q |
204 |
ttgggaggacccaaaatttgttccgcaatgcctttca |
240 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
37419392 |
ttgggaggacccaaaaattgttccggaatgcctttca |
37419428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 222 - 338
Target Start/End: Original strand, 43359944 - 43360060
Alignment:
| Q |
222 |
tgttccgcaatgcctttcactacacctcaaaacttgcatatttcagaatttcataggccaacagggtgagcttatgtcaacaatatatattctgaagaat |
321 |
Q |
| |
|
|||||||| ||| ||||| ||||||| |||||||||| | || | | |||| ||||||||| |||||| || || | ||| ||| ||||| || ||| |
|
|
| T |
43359944 |
tgttccgcggtgcatttcattacaccttaaaacttgcacactttggtacttcagaggccaacatggtgaggttcagttagcaacatacattcttaataat |
43360043 |
T |
|
| Q |
322 |
gcaagagttttgcaaac |
338 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43360044 |
gcaagagttttgcaaac |
43360060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 338
Target Start/End: Original strand, 49415939 - 49416089
Alignment:
| Q |
191 |
atgtccagaaaaattgggaggacc---caaaatttgttccgcaatgcctttcactacacctcaaaacttgcatatttcagaatttcataggccaacaggg |
287 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||||||| ||| | |||||| |||| || |||||||||| | ||| ||| ||| ||||| || | || |
|
|
| T |
49415939 |
atgtccatgaaaattgggaggaccacccaatatttgttccacaaagtctttcattacaacttaaaacttgcaaacttctgaacttcttaggcgaagaagg |
49416038 |
T |
|
| Q |
288 |
tgagcttatgtcaacaatatatattctgaagaatgcaagagttttgcaaac |
338 |
Q |
| |
|
|||||| | | ||| ||| ||| |||||||||| |||||||||||||| |
|
|
| T |
49416039 |
cgagcttctattggcaagatacattttgaagaatgctagagttttgcaaac |
49416089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University