View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15696_low_18 (Length: 334)
Name: NF15696_low_18
Description: NF15696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15696_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 51 - 273
Target Start/End: Complemental strand, 49351084 - 49350862
Alignment:
| Q |
51 |
ttttctttcagaccagctattatactaagtgtgtgtttgatttgatcagctaaatagattttatatgtaacttgcataaatttgacagcaaagcattcca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49351084 |
ttttctttcagaccagctattatactaagtgtgtgtttgatttgatcagctaaatagattttatatgtaacttgcataaatttgacagcaaagcattcca |
49350985 |
T |
 |
| Q |
151 |
ataatgtaaacagaatattatgaggacaattaaaggtaatagtgaaaagatatgtgtgtgtcggaccaatatatttcagaatcaattacatcttgcttta |
250 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49350984 |
ataatgtaaacagaatattatgaggataattaaaggaaatagtgaaaagatatgtgtgtgtcggaccaatatatttcagaatcaattacatcttgcttta |
49350885 |
T |
 |
| Q |
251 |
tgcttttagttgaatcaatttta |
273 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49350884 |
tgcttttagttgaatcaatttta |
49350862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University